Use of DNA in forensic entomology
You don't need to be Editor-In-Chief to add or edit content to WikiDoc. You can begin to add to or edit text on this WikiDoc page by clicking on the edit button at the top of this page. Next enter or edit the information that you would like to appear here. Once you are done editing, scroll down and click the Save page button at the bottom of the page.
Please Take Over This Page and Apply to be Editor-In-Chief for this topic: There can be one or more than one Editor-In-Chief. You may also apply to be an Associate Editor-In-Chief of one of the subtopics below. Please mail us [1] to indicate your interest in serving either as an Editor-In-Chief of the entire topic or as an Associate Editor-In-Chief for a subtopic. Please be sure to attach your CV and or biographical sketch.
Overview
Forensic entomology contains three aspects: medicocriminal entomology, urban entomology, and stored product entomology. This article focuses more on the medicocriminal aspect and how DNA is analyzed with various blood feeding insects.
Blood meal extraction
In order to extract a blood meal from the abdomen of an insect so that it can be used to isolate and analyze DNA, the insect must first be killed by placing it in 96% ethanol. The killed insect can be stored at -20°C until analysis. When it is time for analysis the DNA must then be extracted by dissecting the posterior end of the abdomen and collecting 25mg of tissue. The cut in the abdomen should be made with a razor blade as close to the posterior as possible to avoid the stomach.[1] Using a DNA extraction kit, the DNA is extracted from the tissue. If the DNA is mixed with samples from more than one individual, it is separated using a species specific primer. Once extracted and isolated, the DNA sample goes through a polymerase chain reaction(PCR), is amplified and identified.
PCR works by analyzing species specific mitochondrial DNA. PCR is currently the most commonly used method of species identification. This results from the fact that it is very sensitive in that it requires only a small amount of biological material, and can also utilize material that is not particularly fresh. The sample can be frozen and stored while still remaining usable for later PCR.
DNA requires one hour to reach the abdomen of an insect, so DNA can be amplified one to forty-four hours after an insect feeds. Some research suggests that the source of a blood meal can be determined up to two months post feeding.
In order to amplify DNA, it first has to be denatured. This is done by exposing the DNA to a 95°C temperature for one minute, followed by thirty cycles of 95°C exposures, each thirty seconds long. The denatured DNA is then mixed with a specific primer. A chromatograph is then conducted on 2% agarose gel, stained, and viewed with UV fluorescence. The DNA is identified by looking for genome specific repetitive elements and by comparing it with known examples.
Haematophagous insects of forensic importance
Humans are constantly fed on by haematophagous (blood feeding) insects. The ingested blood can be recovered and used to identify the person from which it was taken. Bite marks and reactions to bites can be used to place a person in an area where those insects are found.
Order Diptera
The following among the flies (Diptera) have been utilized:[1]
- Mosquitoes, Family Culicidae
- Due to erratic feeding habits, mosquitoes could potentially provide DNA evidence to many people in one area at a certain time. PCR analysis shows that identification of bitten individuals is possible with a low error rate, although multiple mosquitoes would be needed.[1] The insects would need to be collected as soon as possible due to the insect’s high mobility and constant feeding. Research is centered on the mosquito due its widespread presence and affinity for feeding on humans.
- Biting midges, Family Ceratopogonidae
- Tsetse flies, Family Glossinidae
- Sheep keds, Family Hippoboscidae
- Stable and horn flies, Family Muscidae
- Sand flies, Family Phlebotominae
- Moth flies, Family Psychodidae
- Snipe flies, Family Rhagionidae
- Black flies, Family Simuliidae
- Horse flies, Family Tabanidae
Order Siphonaptera
Listed here are fleas commonly encountered by humans that could potentially be used for DNA identification.
- Sticktight and chigoe flea, Family Hectopsyllidae (formerly Tungidae)
- Cat flea (Ctenocephalides felis)
- Northern rat flea (Nosopsyllus fasciatus)
- Human flea (Pulex irritans)
- Oriental rat flea (Xenopsylla cheopis)
Order Hemiptera
- Bedbug (Cimex lectularius)
Cimex lectularius is an obligate parasite of humans. Testing a sample of a residence's bed bug population and screening for bites could reveal possible recent visitors to the structure, as they have been observed to feed approximately once a week in temperate conditions.[1] A recent re-emergence of bedbug populations in North America as well as growing interest in the field of forensics may prove bedbugs to be useful investigative tools.[1]
- Assassin bugs, Family Reduviidae
Order Phthiraptera
Lice can be indicators of contact with another person. Many species closely associated with humans can be easily transferred between individuals. DNA identification of multiple individuals using blood meals from body and head lice has been demonstrated in laboratory settings.[1]
Suborder Anoplura
- Head louse (Pediculus humanus capitis)
- Body louse (Pediculus humanus humanus)
- Pubic louse (Phthirus pubis)
Other Arthropods
Order Ixodida
Due to the low probability of a tick detaching and falling to the ground at the scene of the crime, these may not be highly useful regardless of the large amount of blood and lymph they ingest. However, should an engorged tick be found in an area of interest, it would likely contain sufficient genetic material for identification.
Analysis of collected DNA
DNA identification of species can be a very useful tool in forensic entomology. Although it does not replace conventional identification of species through visual identification, it can be used to differentiate between two species of very similar or identical physical and behavioral characteristics. [1] A thorough identification of the species through conventional methods is needed before an attempt at DNA analysis. This DNA can be obtained from practically any part of the insect, including the body, leg, setae, antennae, etc. There are about one million species described in the world and many more that have still not been identified. A project termed "the barcode of life" was launched by Dr. Paul Herbert, where he identified a gene that is used in cell respiration by all species, but is different in every species. This difference in sequence can help entomologists easily identify two similar species.
DNA sequencing is basically done in three steps: polymerase chain reaction (PCR), followed by a sequencing reaction, then gel electrophoresis. PCR is a step that cleaves the long chain of chromosomes into much shorter and workable pieces. These pieces are used as patterns to create a set of fragments. These fragments are different in length from each other by one base which is helpful in identification. Those sets of fragments are then separated by gel electrophoresis.[1] This process uses electricity to separate DNA fragments by size as they move through a gel matrix. With the presence of an electric current the negative DNA strand marches toward the positive pole of the current. The smaller DNA fragments move through the gel pores much more easily/faster than larger molecules. At the bottom of the gel the fragments go through a laser beam that emits a distinct color according to the base that passes through.
Case studies
Case Study #1
Research has already demonstrated the link between forensic entomology and society by amplifying human DNA from blood meals through various methods. A case in Italy involving the murder of a woman utilized this technique in order to link to a suspect.
The woman’s body was discovered partially covered by sand on a beach in Sicily. Investigators suspected a prominent businessman whose car was observed in the area the night of the murder. During investigation of the suspect’s home no substantial evidence was collected apart from a mosquito blood meal stain on the wall. The stain was absorbed on wet filter paper and then scratched to recover the rest of the blood material off the wall. The insect’s remains were also collected in a tube for species identification. DNA was extracted from the collected blood sample and a PCR was performed. The DNA was identified as the victim’s, therefore at least placing the victim in the vicinity, if not in, the suspect’s home. The mosquito was identified as C. pipiens, a species that is not known to travel far distances, such as the distance between the suspect’s home and the beach where the victim was found. [1] This evidence, along with grains of sand and leaf fragments found on the suspect’s clothing that matched those found at the beach, helped to convict the suspect of second degree murder. This also relates forensic entomology and the law.
Case Study #2
Forensic Entomologist, Dr. Jeff Wells [1] from West Virginia University, worked on this specific case.
The evidence (no details were provided as to the circumstances surrounding their collection) was received as two shipping forms and 17 gelatin capsules, each of which contained a hand-written label and either a dried fly larva (maggot), what appeared to be a fragment of adult insect cuticle, or what appeared to be a fragment of insect pupal cuticle (puparium).
A DNA extraction procedure was performed on each specimen using the commercial kit sold by Qiagen. Each sample was subjected to chemical digestion but no deliberate mechanical damage. The middle portion was cut out of the body of the larvae specimens for digestion and DNA extraction following the manufacturer's instructions. Any tissue from the middle section that remained following digestion, plus the unprocessed anterior and posterior sections of each larva have been stored with the original label in a screw-cap vial filled with 95% ethanol. All material from a non-larval specimen was digested. Any fragments that remained following the extraction procedure were stored in ethanol as above. The outside of each vial was labeled with the extraction number.
Mitochondrial DNA sequence analysis was attempted on each DNA extract as described in Wells and Sperling [1] using PCR and sequencing primers C1-J-1751 and C1-N-2191.
The results from the PCR experiment showed that the DNA analysis was successful with eight larval specimens. Analysis on the insect cuticle proved unsuccessful as no mitochondrial DNA was able to be extracted. The portion of the mitochondrial DNA molecule characterized by these procedures corresponds to base positions 1752–2190 of the commonly used system first established for [[Drosophila yakuba]]. The sequences (also known as haplotypes) obtained ranged from 414 bases to 439 bases in length. Below is an example of a larvae specimen DNA analysis.
Specimen 4
TCGGATAAACAATATAAGTTTCTGACTTTTACCTCCTGCATTAACTTTACTATTAGTAAGTAGTATAGTGGAAAACGGAGCTGGAACAGGATGAACTGTT
TACCCACCTTTATCATCTAATATCGCTCATGGAGGAGCTTCTGTTGATTTAGCTATTTTTTCTTTACACTTAGCAGGAATTTCTTCAATTTTAGGAGCTG
TAAATTTTATTACAACAGTTATTAATATACGATCAACAGGAATTACTTTTGACCGAATACCACTATTCGTTTGATCAGTAGTAATTACAGCTTTATTACT
TTTACTATCTTTACCTGTTCTAGCTGGTGCTATTACAATATTATTAACAGACCGAAACCTTAATACTTCATTCTTCGACCCAGCAGGAGGAGGAGACCCA
ATTCTATACCAACATTTATTTTGATTTTTTGGTCACCCT
Species determination was done based on a mitochondrial DNA (mtDNA) haplotype. Three specimens produced the same haplotype, matching the previously published haplotype for the calliphorid fly species Cynomya cadaverina and therefore being identified as such.
[1]
Several specimens produced three very closely related haplotypes, indicating that
they are all the same species. However, these haplotypes are not closely related to any previously published or unpublished data. Therefore these specimens cannot be identified
based solely on haplotype data, although they are definitely not members of the forensically important and extensively studied fly families Calliphoridae or Sarcophagidae. There are several common carrion-feeding species in the family Muscidae that have not been investigated using DNA methods, and one of these species, Hydrotea dentipes, fits the general appearance of these specimens. Given the current state of the science these specimens cannot be identified using DNA analysis.
Conclusion
Forensic entomology is a very important aspect for law enforcement. With the magnitude of information that can be gathered, investigators can more accurately determine time of death, location, how long a body has been in a specific area, if it has been moved, and other important factors. Because of this range of uses, forensic entomology is an extremely significant tool used by law enforcement officials to aid in numerous cases. As this branch of entomology progresses it will become a key facet in all investigations due to its steadily rising popularity and usefulness.
References
Acknowledgement and Attribution Regarding Sources of Content
Some of the initial content on this page may be incorporated in part from copyleft sources in the public domain including wikis such as Wikipedia and AskDrWiki. Drug information for patients came from the The National Library of Medicine. Infectious disease information may have come from the Centers for Disease Control (CDC). Differential Diagnoses are drawn from clinicians as well as an amalgamation of 3 sources: 1.The Disease Database; 2. Kahan, Scott, Smith, Ellen G. In A Page: Signs and Symptoms. Malden, Massachusetts: Blackwell Publishing, 2004:3; 3. Sailer, Christian, Wasner, Susanne. Differential Diagnosis Pocket. Hermosa Beach, CA: Borm Bruckmeir Publishing LLC, 2002:7 .

