X-linked congenital stationary night blindness
You don't need to be Editor-In-Chief to add or edit content to WikiDoc. You can begin to add to or edit text on this WikiDoc page by clicking on the edit button at the top of this page. Next enter or edit the information that you would like to appear here. Once you are done editing, scroll down and click the Save page button at the bottom of the page.
| X-linked congenital stationary night blindness Classification and external resources | |
| Malfunction in transmission from the photoreceptors in the outer nuclear layer to bipolar cells in the inner nuclear layer underlies CSNB. | |
| ICD-10 | H53.6 |
| ICD-9 | 368.61 |
| OMIM | 310500 300071 |
| DiseasesDB | 32689 |
| MedlinePlus | 003039 |
X-linked congenital stationary night blindness (CSNB) is a rare X-linked non-progressive retinal disorder. It has two forms, complete, also known as type-1 (CSNB1), and incomplete, also known as type-2 (CSNB2), depending on severity. In the complete form (CSNB1), there is no measurable rod cell response to light, whereas this response is measurable in the incomplete form. Patients with this disorder have difficulty adapting to low light situations due to impaired photoreceptor transmission. These patients also often have reduced visual acuity, myopia, nystagmus, and strabismus. CSNB1 is caused by mutations in the gene NYX, which encodes a protein involved in retinal synapse formation or synaptic transmission. CSNB2 is caused by mutations in the gene CACNA1F, which encodes a voltage-gated calcium channel CaV1.4.
Symptoms
The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of myopia, which is typically absent in the autosomal forms. Patients with CSNB often have impaired night vision, myopia, reduced visual acuity, strabismus, and nystagmus. Individuals with the complete form of CSNB (CSNB1) have highly impaired rod sensitivity (reduced ~300x) as well as cone dysfunction. Patients with the incomplete form can present with either myopia or hyperopia.[1]
Cause
CSNB was originally believed to be caused by malfunction in neurotransmission from rods to bipolar cells in the retina. This is due to electroretinogram (ERG) measurements on CSNB patients which show a drastic decrease in the size of the scotopic b-wave in comparison to the a-wave, in CSNB2, or a complete loss of both in CSNB1. The a-wave is believed to represent the response of rods to visual input and remains largely unchanged in CSNB2 patients. The b-wave, however, is believed to result from electrical activity of bipolar cells and is decreased or non-existent in both CSNB1 and 2. CSNB1 patients also show mildly altered cone activity. Further study has demonstrated that the defects found in CSNB patients are better explained by more general defects in both the rod and cone ON-signaling pathways.
Pathophysiology
CSNB1
The complete form of X-linked congenital stationary night blindness, also known as nyctalopia, is caused by mutations in the NYX (Nyctalopin on X-chromosome), which encodes a small leucine-rich repeat (LRR) family protein of unknown function.[1][1] This protein consists of an N-terminal signal peptide and 11 LRRs (LRR1-11) flanked by cysteine-rich LRRs (LRRNT and LRRCT). At the C-terminus of the protein there is a putative GPI anchor site. Although the function of NYX is yet to be fully understood, it is believed to be located extracellularly. A naturally occurring deletion of 85 bases in NYX in some mice leads to the "nob" (no b-wave) phenotype, which is highly similar to that seen in CSNB1 patients.[1] NYX is expressed primarily in the rod and cone cells of the retina. There are currently almost 40 known mutations in NYX associated with CSNB1, Table 1., located throughout the protein. As the function of the nyctalopin protein is unknown, these mutations have not been further characterized. However, many of them are predicted to lead to truncated proteins that, presumably, are non-functional.
| Mutation | Position | References | |
|---|---|---|---|
| Nucleotide | Amino acid | ||
| c.?-1_?-61del | 1_20del | Signal sequence | [1] |
| Splicing | Intron 1 | [1] | |
| c.?-63_1443-?del | 21_481del | [1] | |
| c.48_64del | L18RfsX108 | Signal sequence | [1] |
| c.85_108del | R29_A36del | N-terminal LRR | [1] |
| c.G91C | C31S | LRRNT | [1] |
| c.C105A | C35X | LRRNT | [1] |
| c.C169A | P57T | LRRNT | [1] |
| c.C191A | A64E | LRR1 | [1] |
| c.G281C | R94P | LRR2 | [1] |
| c.301_303del | I101del | LRR2 | [1] |
| c.T302C | I101T | LRR2 | [1] |
| c.340_351del | E114_A118del | LRR3 | [1], [1] |
| c.G427C | A143P | LRR4 | [1] |
| c.C452T | P151L | LRR4 | [1] |
| c.464_465insAGCGTGCCCGAGCGCCTCCTG | S149_V150dup+P151_L155dup | LRR4 | [1] |
| c.C524G | P175R | LRR5 | [1] |
| c.T551C | L184P | LRR6 | [1] |
| c.556_618delins | H186?fsX260 | LRR6 | [1] |
| c.559_560delinsAA | A187K | LRR6 | [1] |
| c.613_621dup | 205_207dup | LRR7 | [1], [1] |
| c.628_629ins | R209_S210insCLR | LRR7 | [1] |
| c.T638A | L213Q | LRR7 | [1] |
| c.A647G | N216S | LRR7 | [1], [1] |
| c.T695C | L232P | LRR8 | [1] |
| c.727_738del | 243_246del | LRR8 | [1] |
| c.C792G | N264K | LRR9 | [1] |
| c.T854C | L285P | LRR10 | [1] |
| c.T893C | F298S | LRR10 | [1] |
| c.C895T | Q299X | LRR10 | [1] |
| c.T920C | L307P | LRR11 | [1] |
| c.A935G | N312S | LRR11 | [1] |
| c.T1040C | L347P | LRRCT | [1] |
| c.G1049A | W350X | LRRCT | [1] |
| c.G1109T | G370V | LRRCT | [1] |
| c.1122_1457del | S374RfsX383 | LRRCT | [1], [1] |
| c.1306del | L437WfsX559 | C-terminus | [1] |
| LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs. | |||
CSNB2
The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina.[1][1] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptors depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization.[1] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.[1] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.
| Mutation | Position | Effect | References | |
|---|---|---|---|---|
| Nucleotide | Amino Acid | |||
| c.C148T | R50X | N-terminus | [1] | |
| c.151_155delAGAAA | R51PfsX115 | N-terminus | [1] | |
| c.T220C | C74R | N-terminus | [1] | |
| c.C244T | R82X | N-terminus | [1], [1] | |
| c.466_469delinsGTAGGGGTGCT CCACCCCGTAGGGGTGCTCCACC | S156VdelPinsGVKHOVGVLH | D1S2-3 | [1], [1], [1] | |
| Splicing | Intron 4 | [1] | ||
| c.T685C | S229P | D1S4-5 | [1] | |
| c.G781A | G261R | D1-pore | [1] | |
| c.G832T | E278X | D1-pore | [1], [1] | |
| c.904insG | R302AfsX314 | D1-pore | [1] | |
| c.951_953delCTT | F318del | D1-pore | [1]
| |
| c.G1106A | G369D | D1S6 | Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca2+ permeability. | [1], [1], [1], [1], [1] |
| c.1218delC | W407GfsX443 | D1-2 | [1], [1], [1] | |
| c.C1315T | Q439X | D1-2 | [1] | |
| c.G1556A | R519Q | D1-2 | Decreased expression | [1], [1] |
| c.C1873T | R625X | D2S4 | [1], [1] | |
| c.G2021A | G674D | D2S5 | [1], [1], [1] | |
| c.C2071T | R691X | D2-pore | [1] | |
| c.T2258G | F753C | D2S6 | [1] | |
| c.T2267C | I756T | D2S6 | Activates ~35mV more negative than wild-type, inactivates more slowly | [1] |
| Splicing | Intron 19 | [1] | ||
| c.T2579C | L860P | D2-3 | [1] | |
| c.C2683T | R895X | D3S1-2 | [1], [1], [1], [1] | |
| Splicing | Intron 22 | [1], [1] | ||
| Splicing | Intron 22 | [1] | ||
| c.C2783A | A928D | D3S2-3 | [1], [1] | |
| c.C2905T | R969X | D3S4 | [1], [1] | |
| c.C2914T | R972X | D3S4 | [1] | |
| Splicing | Intron24 | [1] | ||
| c.C2932T | R978X | D3S4 | [1] | |
| c.3006_3008delCAT | I1003del | D3S4-5 | [1] | |
| c.G3052A | G1018R | D3S5 | [1] | |
| c.3125delG | G1042AfsX1076 | D3-pore | [1] | |
| c.3166insC | L1056PfsX1066 | D3-pore | [1], [1], [1], [1] | |
| c.C3178T | R1060W | D3-pore | [1], [1] | |
| c.T3236C | L1079P | D3-pore | Does not open without BayK, activates ~5mV more negative than wild-type | [1], [1] |
| c.3672delC | L1225SfsX1266 | D4S2 | [1], [1] | |
| c.3691_3702del | G1231_T1234del | D4S2 | [1], [1] | |
| c.G3794T | S1265I | D4S3 | [1] | |
| c.C3886A | R1296S | D4S4 | [1] | |
| c.C3895T | R1299X | D4S4 | [1], [1], [1] | |
| Splicing | Intron 32 | [1] | ||
| c.C4075T | Q1359X | D4-pore | [1], [1] | |
| c.T4124A | L1375H | D4-pore | Decreased expression | [1], [1], [1] |
| Splicing | Intron 35 | [1] | ||
| c.G4353A | W1451X | C-terminus | Non-functional | [1], [1], [1], [1] |
| c.T4495C | C1499R | C-terminus | [1] | |
| c.C4499G | P1500R | C-terminus | [1] | |
| c.T4523C | L1508P | C-terminus | [1] | |
| Splicing | intron 40 | [1] | ||
| c.4581delC | F1528LfsX1535 | C-terminus | [1] | |
| c.A4804T | K1602X | C-terminus | [1], [1] | |
| c.C5479T | R1827X | C-terminus | [1] | |
| c.5663delG | S1888TfsX1931 | C-terminus | [1] | |
| c.G5789A | R1930H | C-terminus | [1] | |
Footnotes
Acknowledgement and Attribution Regarding Sources of Content
Some of the initial content on this page may be incorporated in part from copyleft sources in the public domain including wikis such as Wikipedia and AskDrWiki. Drug information for patients came from the The National Library of Medicine. Infectious disease information may have come from the Centers for Disease Control (CDC). Differential Diagnoses are drawn from clinicians as well as an amalgamation of 3 sources: 1.The Disease Database; 2. Kahan, Scott, Smith, Ellen G. In A Page: Signs and Symptoms. Malden, Massachusetts: Blackwell Publishing, 2004:3; 3. Sailer, Christian, Wasner, Susanne. Differential Diagnosis Pocket. Hermosa Beach, CA: Borm Bruckmeir Publishing LLC, 2002:7 .

